| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:46:40 |
| Analysis completed | 2025-04-03 05:46:40 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Aphididae |
| taxa_of_interest |
Aphis gossypii Aphididae |
| country | China |
| host | Cut flower Paenonia |
| sample_id | VE24-1067_COI |
| Query DNA sequence |
>VE24-1067_COI AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGTTCTTCTCTTAGAATTTT AATCCGATTAGAATTAAGTCAAATTAATTCAATTATTAATAATAATCAATTATATAATGT AATTGTTACAATTCATGCTTTTATTATAATTTTTTTTATAACTATACCAATCGTTATTGG AGGTTTTGGAAATTGATTAATTCCTATAATAATAGGATGTCCAGATATATCTTTTCCACG ACTAAATAATATTAGATTCTGATTATTACCACCCTCATTAATAATAATAATTTGCAGATT TATAATTAATAACGGAACAGGAACAGGATGAACTATTTATCCACCTTTATCAAATAATAT TGCTCATAATAATATTTCAGTAGACTTAACTATTTTTTCCCTACATTTAGCAGGTATCTC ATCAATTTTAGGAGCAATTAATTTCATCTGTACTATCTTAAATATAATACCTAATAATAT AAAATTAAATCAAATTCCTCTATTTCCATGATCAATTTTAATTACAGCTATATTATTAAT TTTATCCTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAAATTTAAA TACATCATTTTTTGATCCAGCAGGTGGGGGAGACCCTATTCTTTATCAACATTTATTT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1NA: Assessment of related species is only possible for taxa at rank genus/species Flag 5.2NA: Assessment of related species is only possible for taxa at rank genus/species |
|
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 446 | 15 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Aphis gossypii | 428 | 100.0% | 0.0 |
| Aphis nivalis | 1 | 100.0% | 0.0 |
| Aphis chloris | 1 | 99.8% | 0.0 |
| Aphis clerodendri | 2 | 99.8% | 0.0 |
| Aphis confusa | 3 | 99.8% | 0.0 |
| Aphis sp. BOLD:AAA3070 | 1 | 99.8% | 0.0 |
| Aphis sedi | 1 | 99.8% | 0.0 |
| Aphis taraxacicola | 2 | 99.8% | 0.0 |
| Aphis hypericiphaga | 1 | 99.5% | 0.0 |
| Aphis egomae | 1 | 99.2% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KY679353 | Aphis gossypii clone hbs10 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 2 | EU930152 | Aphis gossypii strain Cot-Aus-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 3 | MN319724 | Aphis gossypii voucher NIBGE APH-00656 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 4 | MN320298 | Aphis gossypii voucher NIBGE APH-00657 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 5 | MH215171 | Aphis gossypii voucher RGF3167A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 6 | KY679362 | Aphis gossypii clone hbs19 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 7 | MH632726 | Aphis gossypii isolate AgCITR cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 8 | KY679310 | Aphis gossypii clone grd7 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 9 | MH215156 | Aphis gossypii voucher RGF3209A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 10 | MN320238 | Aphis gossypii voucher NIBGE APH-00137 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 11 | MH215201 | Aphis gossypii voucher RGF3210A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 12 | KY679387 | Aphis gossypii clone okr4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 13 | MN319934 | Aphis gossypii voucher NIBGE APH-00724 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 14 | AB506727 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos2 | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 15 | MH215155 | Aphis gossypii voucher RGF3220A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 16 | MN320139 | Aphis gossypii voucher NIBGE APH-00576 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 17 | KY679305 | Aphis gossypii clone grd2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 18 | KY679354 | Aphis gossypii clone hbs11 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 19 | KY679425 | Aphis gossypii clone wtm2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 20 | KR085026 | Aphis gossypii voucher Ag12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 21 | MN319973 | Aphis gossypii voucher NIBGE APH-00701 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 22 | MN320044 | Aphis gossypii voucher NIBGE APH-00043 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 23 | MW315432 | Aphis gossypii voucher A27 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 24 | MH215166 | Aphis gossypii voucher RGF3224A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 25 | MH215187 | Aphis gossypii voucher RGF3208A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 26 | MN319902 | Aphis gossypii voucher NIBGE APH-00058 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 27 | MH215196 | Aphis gossypii voucher RGF2752A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 28 | KR085032 | Aphis gossypii voucher Ag18 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 29 | MN319805 | Aphis gossypii voucher NIBGE APH-00313 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 30 | KY679347 | Aphis gossypii clone hbs4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 31 | KR085025 | Aphis gossypii voucher Ag11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 32 | MH395847 | Aphis gossypii voucher GTB269DN1831 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 33 | ON430541 | Aphis gossypii voucher CUAG-AR01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 34 | MN319838 | Aphis gossypii voucher NIBGE APH-00189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 35 | KY679308 | Aphis gossypii clone grd5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 36 | MW315418 | Aphis gossypii voucher A13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 37 | MN320033 | Aphis gossypii voucher NIBGE APH-00341 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 38 | OR449278 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 39 | MN320071 | Aphis gossypii voucher NIBGE APH-00595 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 40 | MN320299 | Aphis gossypii voucher NIBGE APH-00597 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 41 | MN320349 | Aphis gossypii voucher NIBGE APH-00435 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 42 | MN320344 | Aphis gossypii voucher NIBGE APH-00704 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 43 | KR085028 | Aphis gossypii voucher Ag14 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 44 | EU930156 | Aphis gossypii strain Pep-2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 45 | MN320195 | Aphis gossypii voucher NIBGE APH-00588 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 46 | MN320336 | Aphis gossypii voucher NIBGE APH-00589 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 47 | MN320010 | Aphis gossypii voucher NIBGE APH-00591 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 48 | MH395846 | Aphis gossypii voucher GTB265DN1829 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 49 | MN320322 | Aphis gossypii voucher NIBGE APH-00055 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 50 | KY679329 | Aphis gossypii clone cmb6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 51 | MH215165 | Aphis gossypii voucher RGF3164A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 52 | MN319994 | Aphis gossypii voucher NIBGE APH-00611 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 53 | KR085029 | Aphis gossypii voucher Ag15 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 54 | PQ039735 | Aphis gossypii isolate ag19 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 55 | MW315433 | Aphis gossypii voucher A28 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 56 | KY679360 | Aphis gossypii clone hbs17 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 57 | MN319874 | Aphis gossypii voucher NIBGE APH-00619 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 58 | MN320084 | Aphis gossypii voucher NIBGE APH-00652 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 59 | MN320035 | Aphis gossypii voucher NIBGE APH-00042 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 60 | MN319938 | Aphis gossypii voucher NIBGE APH-00590 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 61 | MH215162 | Aphis gossypii voucher RGF3158A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 62 | KY679358 | Aphis gossypii clone hbs15 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 63 | KR085027 | Aphis gossypii voucher Ag13 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 64 | MW315420 | Aphis gossypii voucher A15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 65 | MN319924 | Aphis gossypii voucher NIBGE APH-00414 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 66 | MN319942 | Aphis gossypii voucher NIBGE APH-00709 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 67 | MG432001 | Aphis gossypii isolate wusu505 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 68 | KY679351 | Aphis gossypii clone hbs8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 69 | MZ662894 | Aphis gossypii isolate YamAphid-1A-YWA-2020 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 70 | MG432004 | Aphis gossypii isolate bole790 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 71 | MN319895 | Aphis gossypii voucher NIBGE APH-00620 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 72 | EU701339 | Aphis gossypii voucher CNC#HEM054618 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 73 | EU930155 | Aphis gossypii strain Pep-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 74 | MN319887 | Aphis gossypii voucher NIBGE APH-00612 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 75 | MN320153 | Aphis gossypii voucher NIBGE APH-00596 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 76 | MN319888 | Aphis gossypii voucher NIBGE APH-00368 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 77 | EU930153 | Aphis gossypii strain Cot-Aus-2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 78 | MN320055 | Aphis gossypii voucher NIBGE APH-00723 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 79 | EU930154 | Aphis gossypii strain Cuc-Fra cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 80 | MH215172 | Aphis gossypii voucher RGF3203A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 81 | MN320146 | Aphis gossypii voucher NIBGE APH-00644 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 82 | MN320000 | Aphis gossypii voucher NIBGE APH-00622 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 83 | MN319999 | Aphis gossypii voucher NIBGE APH-00621 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 84 | MH215176 | Aphis gossypii voucher RGF3213A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 85 | MN320327 | Aphis gossypii voucher NIBGE APH-00715 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 86 | MH215157 | Aphis gossypii voucher RGF2666A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 87 | MH215203 | Aphis gossypii voucher RGF3175A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 88 | MN320252 | Aphis gossypii voucher NIBGE APH-00617 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 89 | MN320286 | Aphis gossypii voucher NIBGE APH-00447 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 90 | AB506728 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos3 | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 91 | EU930150 | Aphis gossypii strain Cot-Cam-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 92 | PP349796 | Aphis gossypii isolate Ag16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 93 | MN320051 | Aphis gossypii voucher NIBGE APH-00592 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 94 | MK994521 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 95 | OP002053 | Aphis gossypii isolate klp2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 96 | KY679371 | Aphis gossypii clone pmk8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 97 | KR017751 | Aphis gossypii voucher DOGR 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 98 | MN320031 | Aphis gossypii voucher NIBGE APH-00434 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 99 | MN319913 | Aphis gossypii voucher NIBGE APH-00154 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 100 | MF322542 | Aphis gossypii cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 101 | MN320150 | Aphis gossypii voucher NIBGE APH-00705 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 102 | MH215181 | Aphis gossypii voucher RGF2756A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 103 | MH215158 | Aphis gossypii voucher RGF2765A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 104 | MH215197 | Aphis gossypii voucher RGF2761A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 105 | KR085017 | Aphis gossypii voucher Ag3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 106 | EU930151 | Aphis gossypii strain Cot-Sen cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 107 | KY679426 | Aphis gossypii clone wtm3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 108 | MN319927 | Aphis gossypii voucher NIBGE APH-00567 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 109 | KY679443 | Aphis gossypii clone wtm20 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 110 | MN320288 | Aphis gossypii voucher NIBGE APH-00714 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 111 | OP002049 | Aphis gossypii isolate kmd2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 112 | MH215178 | Aphis gossypii voucher RGF2758A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 113 | KY679348 | Aphis gossypii clone hbs5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 114 | MG432003 | Aphis gossypii isolate shache779 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 115 | MN319741 | Aphis gossypii voucher NIBGE APH-00700 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 116 | MN320356 | Aphis gossypii voucher NIBGE APH-00062 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 117 | MH407718 | Aphis gossypii isolate AG32_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 118 | MN319740 | Aphis gossypii voucher NIBGE APH-00122 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 119 | KY679379 | Aphis gossypii clone pmk16 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 120 | MN320230 | Aphis gossypii voucher NIBGE APH-00679 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 121 | MK766467 | Aphis gossypii voucher T1A2 haplotype Ag1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 122 | MN320325 | Aphis gossypii voucher NIBGE APH-00616 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 123 | NC_024581 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 124 | MN319989 | Aphis gossypii voucher NIBGE APH-00056 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 125 | MN319885 | Aphis gossypii voucher NIBGE APH-00568 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 126 | MN320157 | Aphis gossypii voucher NIBGE APH-00711 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 127 | KY679424 | Aphis gossypii clone wtm1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 128 | MG432005 | Aphis gossypii isolate shache804 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 129 | MN320213 | Aphis gossypii voucher NIBGE APH-00618 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 130 | MG432000 | Aphis gossypii isolate akesu633 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 131 | KY679435 | Aphis gossypii clone wtm12 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 132 | MH215190 | Aphis gossypii voucher RGF3176A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 133 | MH215175 | Aphis gossypii voucher RGF3206A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 134 | MN320049 | Aphis gossypii voucher NIBGE APH-00624 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 135 | MZ662889 | Aphis gossypii isolate YamAphid-4AR-YWA-2019 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 136 | MN319721 | Aphis gossypii voucher NIBGE APH-00267 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 137 | MG432002 | Aphis gossypii isolate shihezi773 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 138 | MH215170 | Aphis gossypii voucher RGF2760A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 139 | MN320334 | Aphis gossypii voucher NIBGE APH-00658 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 140 | MN320072 | Aphis gossypii voucher NIBGE APH-00585 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 141 | MH215205 | Aphis gossypii voucher RGF3165A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 142 | MN320345 | Aphis gossypii voucher NIBGE APH-00149 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 143 | MG431998 | Aphis gossypii isolate zepu106 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 144 | MN320106 | Aphis gossypii voucher NIBGE APH-00358 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 145 | MZ662886 | Aphis gossypii isolate YamAphid-11AR-YWA-2018 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 146 | KR085022 | Aphis gossypii voucher Ag8 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 147 | MN320127 | Aphis gossypii voucher NIBGE APH-00050 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 148 | MG431999 | Aphis gossypii isolate kuerle242 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 149 | MN319830 | Aphis gossypii voucher NIBGE APH-00060 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 150 | MG954460 | Aphis gossypii isolate Y13 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 151 | MH215148 | Aphis gossypii voucher RGF3229A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 152 | KY835677 | Aphis gossypii voucher BIOUG02532-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 153 | MN320133 | Aphis gossypii voucher NIBGE APH-00544 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 154 | KR085024 | Aphis gossypii voucher Ag10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 155 | EU930163 | Aphis gossypii strain Pot-8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 156 | MN320296 | Aphis gossypii voucher NIBGE APH-00148 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 157 | MH215182 | Aphis gossypii voucher RGF3168A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 158 | MN319754 | Aphis gossypii voucher NIBGE APH-00594 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 159 | MG432006 | Aphis gossypii isolate shihezi795 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 160 | KR085033 | Aphis gossypii voucher Ag19 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 161 | MN320130 | Aphis gossypii voucher NIBGE APH-00061 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 162 | EU930160 | Aphis gossypii strain Aub-Guad cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 163 | MN319771 | Aphis gossypii voucher NIBGE APH-00680 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 164 | MH215183 | Aphis gossypii voucher RGF3162A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 165 | MH215168 | Aphis gossypii voucher RGF2665A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 166 | MT430940 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 167 | OK181865 | Aphis gossypii isolate CRM3_CB cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 168 | MN320089 | Aphis gossypii voucher NIBGE APH-00703 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 169 | KR085018 | Aphis gossypii voucher Ag2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 170 | MH215160 | Aphis gossypii voucher RGF3172A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 171 | MN319920 | Aphis gossypii voucher NIBGE APH-00546 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 172 | MW315414 | Aphis gossypii voucher A08 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 173 | MW048625 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 174 | MH215200 | Aphis gossypii voucher RGF3221A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 175 | MK766466 | Aphis gossypii voucher RL2A1 haplotype Ag1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 176 | KY831799 | Aphis gossypii voucher BIOUG02439-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 177 | MN320093 | Aphis gossypii voucher NIBGE APH-00662 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 178 | MH215180 | Aphis gossypii voucher RGF2759A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 179 | MH203408 | Aphis gossypii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 180 | KY679369 | Aphis gossypii clone pmk6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 181 | MN320164 | Aphis gossypii voucher NIBGE APH-00712 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 182 | MN320333 | Aphis gossypii voucher NIBGE APH-00579 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 183 | KT899438 | Aphis gossypii from muskmelon cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 184 | MH215191 | Aphis gossypii voucher RGF3159A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 185 | MH215145 | Aphis gossypii voucher RGF3211A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 186 | OP364845 | Aphis gossypii isolate ypo210517A01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 187 | MH215204 | Aphis gossypii voucher RGF2757A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 188 | MN319769 | Aphis gossypii voucher NIBGE APH-00713 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 189 | KR017753 | Aphis gossypii voucher DOGR 3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 190 | MH215188 | Aphis gossypii voucher RGF3212A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 191 | MH215186 | Aphis gossypii voucher RGF3180A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 192 | KY679344 | Aphis gossypii clone hbs1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 193 | PP917991 | Aphis gossypii voucher ZGMB HJAg cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 194 | MN319725 | Aphis gossypii voucher NIBGE APH-00581 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 195 | KR085023 | Aphis gossypii voucher Ag9 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 196 | MN320206 | Aphis gossypii voucher NIBGE APH-00094 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 197 | MN320262 | Aphis gossypii voucher NIBGE APH-00160 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 198 | MF462147 | Aphis gossypii isolate OAI375 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 199 | EU930157 | Aphis gossypii strain Pep-3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 200 | MN319742 | Aphis gossypii voucher NIBGE APH-00623 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 201 | AB506730 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos5 | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 202 | MN319744 | Aphis gossypii voucher NIBGE APH-00166 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 203 | KY679306 | Aphis gossypii clone grd3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 204 | KY679436 | Aphis gossypii clone wtm13 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 205 | MH215153 | Aphis gossypii voucher RGF2668A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 206 | MN102349 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 207 | OP364846 | Aphis gossypii isolate gpo210517C01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 208 | KY679349 | Aphis gossypii clone hbs6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 209 | MH632729 | Aphis gossypii isolate AgCOUR cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 210 | MW315447 | Aphis gossypii voucher A43 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 211 | MN319772 | Aphis gossypii voucher NIBGE APH-00545 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 212 | MN319850 | Aphis gossypii voucher NIBGE APH-00139 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 213 | KR085021 | Aphis gossypii voucher Ag7 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 214 | KR085030 | Aphis gossypii voucher Ag16 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 215 | KJ702457 | Aphis gossypii voucher ROAgAp4-14 cytochrome c oxidase subunit 1 (cox1) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 216 | KR085020 | Aphis gossypii voucher Ag6 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 217 | KR085031 | Aphis gossypii voucher Ag17 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 218 | MW315442 | Aphis gossypii voucher A38 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 657.0 | 0.00e+00 | 100.0% |
| 219 | EU701355 | Aphis gossypii voucher CNC#HEM113405 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 656.0 | 0.00e+00 | 100.0% |
| 220 | KR085015 | Aphis gossypii voucher Ag5 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 654.0 | 0.00e+00 | 100.0% |
| 221 | OK656717 | Aphis gossypii isolate AG264 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 654 | 99.4% | 654.0 | 0.00e+00 | 100.0% |
| 222 | EU701353 | Aphis gossypii voucher CNC#HEM113410 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 651.0 | 0.00e+00 | 100.0% |
| 223 | KM115481 | Aphis gossypii voucher ZMIOZ WZC027 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 649.0 | 0.00e+00 | 100.0% |
| 224 | KY586076 | Aphis gossypii isolate Modipuram_A32 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 649.0 | 0.00e+00 | 100.0% |
| 225 | KT852943 | Aphis gossypii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 649.0 | 0.00e+00 | 100.0% |
| 226 | KU238088 | Aphis gossypii cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 649 | 98.6% | 649.0 | 0.00e+00 | 100.0% |
| 227 | MW315435 | Aphis gossypii voucher A30 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 649 | 98.6% | 649.0 | 0.00e+00 | 100.0% |
| 228 | KM115477 | Aphis gossypii voucher ZMIOZ LY103 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 647.0 | 0.00e+00 | 100.0% |
| 229 | KU296069 | Aphis gossypii isolate Z3 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 645 | 98.0% | 645.0 | 0.00e+00 | 100.0% |
| 230 | KU296073 | Aphis gossypii isolate X2 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 645 | 98.0% | 645.0 | 0.00e+00 | 100.0% |
| 231 | KU296068 | Aphis gossypii isolate Z2 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 644 | 97.9% | 644.0 | 0.00e+00 | 100.0% |
| 232 | KM115480 | Aphis gossypii voucher ZMIOZ LY122 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 643 | 97.7% | 643.0 | 0.00e+00 | 100.0% |
| 233 | OR077674 | Aphis gossypii isolate UBKV strawberry cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 643 | 97.7% | 643.0 | 0.00e+00 | 100.0% |
| 234 | MH500231 | Aphis gossypii cytochrome oxidase subunit I gene, partial cds; mitochondrial | 641 | 97.4% | 641.0 | 0.00e+00 | 100.0% |
| 235 | MG847522 | Aphis gossypii voucher UNIPG AG 03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 641.0 | 0.00e+00 | 100.0% |
| 236 | MG847523 | Aphis gossypii voucher UNIPG AG 04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 641.0 | 0.00e+00 | 100.0% |
| 237 | KM115478 | Aphis gossypii voucher ZMIOZ LY120 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 641.0 | 0.00e+00 | 100.0% |
| 238 | PQ637208 | Aphis gossypii isolate SKUAST -K cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 640 | 97.3% | 640.0 | 0.00e+00 | 100.0% |
| 239 | OK655837 | Aphis gossypii isolate AG263 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 639 | 97.1% | 639.0 | 0.00e+00 | 100.0% |
| 240 | MN320008 | Aphis gossypii voucher NIBGE APH-00547 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 96.8% | 637.0 | 0.00e+00 | 100.0% |
| 241 | KJ502186 | Aphis gossypii voucher 110921WH17 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 636.0 | 0.00e+00 | 100.0% |
| 242 | KJ502182 | Aphis gossypii voucher 110422HJ1-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 636.0 | 0.00e+00 | 100.0% |
| 243 | GU591547 | Aphis gossypii voucher USNM:396854 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 634.0 | 0.00e+00 | 100.0% |
| 244 | OP002099 | Aphis gossypii isolate vkt2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 634 | 96.4% | 634.0 | 0.00e+00 | 100.0% |
| 245 | MH469607 | Aphis gossypii isolate SMH24 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 628 | 95.4% | 628.0 | 0.00e+00 | 100.0% |
| 246 | MH469608 | Aphis gossypii isolate SMH25 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 628 | 95.4% | 628.0 | 0.00e+00 | 100.0% |
| 247 | MH469609 | Aphis gossypii isolate SMH26 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 628 | 95.4% | 628.0 | 0.00e+00 | 100.0% |
| 248 | MN319706 | Aphis gossypii voucher NIBGE APH-00746 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 95.3% | 627.0 | 0.00e+00 | 100.0% |
| 249 | KJ863360 | Aphis gossypii voucher 110517-YR-4-1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 625 | 95.0% | 625.0 | 0.00e+00 | 100.0% |
| 250 | KR042793 | Aphis nivalis voucher CNC#HEM057313 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 625 | 95.0% | 625.0 | 0.00e+00 | 100.0% |
| 251 | OR050337 | Aphis gossypii voucher 186 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 620 | 94.2% | 620.0 | 0.00e+00 | 100.0% |
| 252 | MH407731 | Aphis gossypii isolate AG1_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 617 | 93.8% | 617.0 | 0.00e+00 | 100.0% |
| 253 | MN320074 | Aphis gossypii voucher NIBGE APH-00195 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 614.0 | 0.00e+00 | 100.0% |
| 254 | MN319831 | Aphis gossypii voucher NIBGE APH-00196 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 614.0 | 0.00e+00 | 100.0% |
| 255 | MN320290 | Aphis gossypii voucher NIBGE APH-00197 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 614.0 | 0.00e+00 | 100.0% |
| 256 | KF286902 | Aphis gossypii voucher ZMIOZ WZC046 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 93.2% | 613.0 | 0.00e+00 | 100.0% |
| 257 | MN320255 | Aphis gossypii voucher NIBGE APH-00307 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 656.0 | 0.00e+00 | 99.8% |
| 258 | MN320144 | Aphis gossypii voucher NIBGE APH-00057 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 656.0 | 0.00e+00 | 99.8% |
| 259 | EU701352 | Aphis gossypii voucher CNC#HEM113412 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 260 | KM268016 | Aphis gossypii voucher ORP SP-LK40 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 261 | MW315445 | Aphis gossypii voucher A41 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 262 | MH215146 | Aphis gossypii voucher RGF3174A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 263 | PP349795 | Aphis gossypii isolate Ag12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 264 | MH215159 | Aphis gossypii voucher RGF3169A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 265 | MW315431 | Aphis gossypii voucher A26 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 266 | AB506731 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos6 | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 267 | MN319936 | Aphis gossypii voucher NIBGE APH-00386 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 268 | KF638752 | Aphis chloris voucher INRA CBGP ACOE1485/chasses1485-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 269 | MN319738 | Aphis gossypii voucher NIBGE APH-00350 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 270 | EU701347 | Aphis gossypii voucher CNC#HEM113430 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 271 | KT899439 | Aphis gossypii from potato cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 272 | EU701401 | Aphis gossypii voucher CNC#HEM050517 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 273 | MH215154 | Aphis gossypii voucher RGF3177A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 274 | EU701371 | Aphis gossypii voucher CNC#HEM050531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 275 | EU701350 | Aphis gossypii voucher CNC#HEM113415 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 276 | KM268011 | Aphis gossypii voucher ORP SP-LK35 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 277 | MN320005 | Aphis gossypii voucher NIBGE APH-00388 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 278 | PP349798 | Aphis gossypii isolate Ag23 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 279 | MH215207 | Aphis gossypii voucher RGF3160A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 280 | KP152428 | Aphis gossypii voucher ORP SP-LK79 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 281 | MW315444 | Aphis gossypii voucher A40 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 282 | KM268015 | Aphis gossypii voucher ORP SP-LK39 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 283 | KP152479 | Aphis gossypii voucher ORP SP-LK130 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 284 | KF446154 | Aphis gossypii voucher ORP SP-LK13 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 285 | KY679304 | Aphis gossypii clone grd1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 286 | MH215193 | Aphis gossypii voucher RGF2672A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 287 | EU701407 | Aphis clerodendri voucher CNC#HEM050872 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 288 | KP152396 | Aphis gossypii voucher ORP SP-LK47 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 289 | AB506726 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos1 | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 290 | MH215177 | Aphis gossypii voucher RGF3161A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 291 | EU701377 | Aphis gossypii voucher CNC#HEM050471 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 292 | KM268000 | Aphis gossypii voucher ORP SP-LK24 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 293 | EU701344 | Aphis gossypii voucher CNC#HEM113449 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 294 | KP152417 | Aphis gossypii voucher ORP SP-LK68 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 295 | KF638758 | Aphis confusa voucher INRA CBGP ACOE1619/chasses1619-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 296 | MW013764 | Aphis gossypii mitochondrion, complete genome | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 297 | KF446156 | Aphis gossypii voucher ORP SP-LK15 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 298 | KF638761 | Aphis confusa voucher INRA CBGP ACOE700/chasses700-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 299 | KP152398 | Aphis gossypii voucher ORP SP-LK49 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 300 | JQ690334 | Aphis gossypii voucher KBRIIHR-41 from India cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 301 | KP152451 | Aphis gossypii voucher ORP SP-LK102 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 302 | MH215198 | Aphis gossypii voucher RGF2754A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 303 | KP152481 | Aphis gossypii voucher ORP SP-LK132 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 304 | KP152464 | Aphis gossypii voucher ORP SP-LK115 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 305 | KR344320 | Aphis sp. BOLD:AAA3070 voucher BIOUG10070-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 306 | JX051430 | Aphis gossypii voucher KBRIIHR-194 cytochrome oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 307 | KP152455 | Aphis gossypii voucher ORP SP-LK106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 308 | KM268002 | Aphis gossypii voucher ORP SP-LK26 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 309 | MN319801 | Aphis gossypii voucher NIBGE APH-00179 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 310 | GQ904112 | Aphis sedi isolate 030511HJ1 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 311 | MH632727 | Aphis gossypii isolate AgHIBI cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 312 | KF639079 | Aphis taraxacicola voucher INRA CBGP ACOE2149/chasses2149-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 313 | KP152468 | Aphis gossypii voucher ORP SP-LK119 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 314 | EU701382 | Aphis gossypii voucher CNC#HEM050543 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 315 | MH215169 | Aphis gossypii voucher RGF3178A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 316 | KP152418 | Aphis gossypii voucher ORP SP-LK69 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 317 | MH215152 | Aphis gossypii voucher RGF2764A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 318 | MN320194 | Aphis gossypii voucher NIBGE APH-00387 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 319 | MH215192 | Aphis gossypii voucher RGF3219A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 320 | KP152465 | Aphis gossypii voucher ORP SP-LK116 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 321 | KF446144 | Aphis gossypii voucher ORP SP-LK3 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 322 | KM268005 | Aphis gossypii voucher ORP SP-LK29 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 323 | KP152459 | Aphis gossypii voucher ORP SP-LK110 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 324 | GU667247 | Aphis gossypii voucher CNC#HEM064124 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 325 | DQ499026 | Aphis gossypii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 654.0 | 0.00e+00 | 99.8% |
| 326 | KM115519 | Aphis gossypii voucher ZMIOZ ZZM061 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 327 | KM115492 | Aphis gossypii voucher ZMIOZ XJY105-2 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 328 | KY586072 | Aphis gossypii isolate Modipuram_CA1 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 329 | KM115494 | Aphis gossypii voucher ZMIOZ XJY105 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 330 | KY586075 | Aphis gossypii isolate Modipuram_BA2 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 331 | KM115487 | Aphis gossypii voucher ZMIOZ XJY034 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 646.0 | 0.00e+00 | 99.8% |
| 332 | KY586074 | Aphis gossypii isolate Modipuram_CA3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 645.0 | 0.00e+00 | 99.8% |
| 333 | MG847521 | Aphis gossypii voucher UNIPG AG 02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 644.0 | 0.00e+00 | 99.8% |
| 334 | MG847520 | Aphis gossypii voucher UNIPG AG 01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 644.0 | 0.00e+00 | 99.8% |
| 335 | KT356160 | Aphis gossypii voucher AGB001 cytochrome oxidase subunit I (COX1) gene, partial cds; mitochondrial | 644 | 97.9% | 641.0 | 0.00e+00 | 99.8% |
| 336 | KM115474 | Aphis gossypii voucher ZMIOZ LY079 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 636.0 | 0.00e+00 | 99.8% |
| 337 | KJ502183 | Aphis gossypii voucher 110519HJ5-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 633.0 | 0.00e+00 | 99.8% |
| 338 | OR835804 | Aphis gossypii voucher Is cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 627 | 95.3% | 624.0 | 0.00e+00 | 99.8% |
| 339 | EU701360 | Aphis gossypii voucher CNC#HEM054977 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 95.3% | 624.0 | 0.00e+00 | 99.8% |
| 340 | EU701348 | Aphis gossypii voucher CNC#HEM113419 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 95.1% | 623.0 | 0.00e+00 | 99.8% |
| 341 | KJ863373 | Aphis gossypii voucher 110520-YR-6-1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 625 | 95.0% | 622.0 | 0.00e+00 | 99.8% |
| 342 | EU701394 | Aphis gossypii voucher CNC#HEM050618 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 612.0 | 0.00e+00 | 99.8% |
| 343 | KF286928 | Aphis gossypii voucher ZMIOZ WZC078 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 93.2% | 610.0 | 0.00e+00 | 99.8% |
| 344 | KF286903 | Aphis gossypii voucher ZMIOZ WZC047 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 93.2% | 610.0 | 0.00e+00 | 99.8% |
| 345 | MN319919 | Aphis gossypii voucher NIBGE APH-00155 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 654.0 | 0.00e+00 | 99.7% |
| 346 | MH632728 | Aphis gossypii isolate AgPOIV cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 654.0 | 0.00e+00 | 99.7% |
| 347 | EU701388 | Aphis gossypii voucher CNC#HEM050533 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 653.0 | 0.00e+00 | 99.7% |
| 348 | MH215149 | Aphis gossypii voucher RGF2671A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 653.0 | 0.00e+00 | 99.7% |
| 349 | GQ904115 | Aphis taraxacicola isolate 050513HJ11 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 350 | KF446145 | Aphis gossypii voucher ORP SP-LK4 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 351 | KP152412 | Aphis gossypii voucher ORP SP-LK63 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 352 | MW315429 | Aphis gossypii voucher A24 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 353 | MH215199 | Aphis gossypii voucher RGF3196A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 354 | MH215174 | Aphis gossypii voucher RGF3191A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 355 | KF446152 | Aphis gossypii voucher ORP SP-LK11 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 356 | JQ690332 | Aphis gossypii voucher KBRIIHR-39 from India cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 357 | KP152450 | Aphis gossypii voucher ORP SP-LK101 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 358 | MH215164 | Aphis gossypii voucher RGF2751A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 359 | GQ904081 | Aphis clerodendri isolate 031009SH32 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 360 | KF638759 | Aphis confusa voucher INRA CBGP ACOE2280/chasses2280-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 361 | MH215189 | Aphis gossypii voucher RGF3189A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 362 | MH215195 | Aphis gossypii voucher RGF3200A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 363 | HM237329 | Aphis gossypii cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 364 | MH215206 | Aphis gossypii voucher RGF3190A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 365 | KF638915 | Aphis gossypii voucher INRA CBGP ACOE1212/chasses1212-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 366 | KP152409 | Aphis gossypii voucher ORP SP-LK60 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 367 | MH215173 | Aphis gossypii voucher RGF2755A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 368 | PQ146890 | Aphis gossypii isolate CITHAg 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 369 | MH215150 | Aphis gossypii voucher RGF3185A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 370 | KF638916 | Aphis gossypii voucher INRA CBGP ACOE1408/chasses1408-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 371 | KP152444 | Aphis gossypii voucher ORP SP-LK95 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 372 | EU701359 | Aphis gossypii voucher CNC#HEM054984 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 373 | KM268009 | Aphis gossypii voucher ORP SP-LK33 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 374 | MN319734 | Aphis gossypii voucher NIBGE APH-00572 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 375 | KY679364 | Aphis gossypii clone pmk1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 376 | EU701370 | Aphis gossypii voucher CNC#HEM050438 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 377 | MW315428 | Aphis gossypii voucher A23 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 378 | MH215147 | Aphis gossypii voucher RGF3199A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 379 | KP152429 | Aphis gossypii voucher ORP SP-LK80 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 380 | MH215185 | Aphis gossypii voucher RGF3195A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 381 | KP152458 | Aphis gossypii voucher ORP SP-LK109 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 382 | MH215184 | Aphis gossypii voucher RGF2670A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 383 | MH215167 | Aphis gossypii voucher RGF2753A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 384 | PQ037178 | Aphis gossypii isolate ag17 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 385 | KP152469 | Aphis gossypii voucher ORP SP-LK120 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 386 | MH215163 | Aphis gossypii voucher RGF3188A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 387 | MH215151 | Aphis gossypii voucher RGF3204A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 388 | EU701380 | Aphis gossypii voucher CNC#HEM050599 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 389 | MH215161 | Aphis gossypii voucher RGF3201A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 390 | MH215202 | Aphis gossypii voucher RGF3186A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 391 | KY679381 | Aphis gossypii clone pmk18 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 392 | JQ690329 | Aphis gossypii voucher KBRIIHR-37 from India cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 393 | AB506729 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos4 | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 394 | EU701390 | Aphis gossypii voucher CNC#HEM050563 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 651.0 | 0.00e+00 | 99.7% |
| 395 | KR032414 | Aphis gossypii voucher CNC#HEM057966 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 651.0 | 0.00e+00 | 99.7% |
| 396 | MW315436 | Aphis gossypii voucher A31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 99.7% | 650.0 | 0.00e+00 | 99.7% |
| 397 | MT710951 | Aphis gossypii isolate Shivamogga cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 650 | 98.8% | 644.0 | 0.00e+00 | 99.7% |
| 398 | KM115527 | Aphis gossypii voucher ZMIOZ ZZM087 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 399 | KY586073 | Aphis gossypii isolate Modipuram_CA2 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 400 | KY586071 | Aphis gossypii isolate Hisar_A86 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 401 | KY586077 | Aphis gossypii isolate Modipuram_BA3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 402 | KY586070 | Aphis gossypii isolate Hisar_A88 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 403 | KM115526 | Aphis gossypii voucher ZMIOZ ZZM081 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 404 | KM115497 | Aphis gossypii voucher ZMIOZ XJY1131 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 405 | KM115479 | Aphis gossypii voucher ZMIOZ LY121 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 643.0 | 0.00e+00 | 99.7% |
| 406 | KM115476 | Aphis gossypii voucher ZMIOZ LY092 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 635.0 | 0.00e+00 | 99.7% |
| 407 | MH407723 | Aphis gossypii isolate AG21_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 626.0 | 0.00e+00 | 99.7% |
| 408 | MN320136 | Aphis gossypii voucher NIBGE APH-00464 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 618 | 93.9% | 613.0 | 0.00e+00 | 99.7% |
| 409 | EU701387 | Aphis gossypii voucher CNC#HEM050602 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 650.0 | 0.00e+00 | 99.5% |
| 410 | KP152416 | Aphis gossypii voucher ORP SP-LK67 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 411 | KP152413 | Aphis gossypii voucher ORP SP-LK64 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 412 | KP152430 | Aphis gossypii voucher ORP SP-LK81 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 413 | MH215194 | Aphis gossypii voucher RGF3187A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 414 | GQ904103 | Aphis hypericiphaga isolate 050616SH29 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 415 | JQ916093 | Aphis gossypii voucher ZMIOZ 13532 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 416 | EU701341 | Aphis gossypii voucher CNC#HEM113492 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 417 | JX051429 | Aphis gossypii voucher KBRIIHR-193 cytochrome oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 418 | MH215179 | Aphis gossypii voucher RGF3223A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 419 | KP152422 | Aphis gossypii voucher ORP SP-LK73 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 420 | KM115475 | Aphis gossypii voucher ZMIOZ LY088 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 640.0 | 0.00e+00 | 99.5% |
| 421 | MN320076 | Aphis gossypii voucher NIBGE APH-00051 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 647.0 | 0.00e+00 | 99.4% |
| 422 | JQ690333 | Aphis gossypii voucher KBRIIHR-40 from India cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 423 | KM267998 | Aphis gossypii voucher ORP SP-LK22 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 424 | MN319819 | Aphis gossypii voucher NIBGE APH-00370 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 425 | KY679405 | Aphis gossypii clone msm2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 426 | JQ067097 | Aphis gossypii voucher KBRIIHR-03 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 427 | KP152395 | Aphis gossypii voucher ORP SP-LK46 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 428 | KP152456 | Aphis gossypii voucher ORP SP-LK107 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 429 | OR685285 | Aphis gossypii voucher SCR1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 430 | KP152463 | Aphis gossypii voucher ORP SP-LK114 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 431 | KY679421 | Aphis gossypii clone msm18 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 432 | JQ067095 | Aphis gossypii voucher KBRIIHR-01 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 433 | MN320355 | Aphis gossypii voucher NIBGE APH-00059 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 648.0 | 0.00e+00 | 99.2% |
| 434 | MN319883 | Aphis gossypii voucher NIBGE APH-00018 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.2% |
| 435 | GQ904084 | Aphis egomae isolate 050809HJ1 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 643.0 | 0.00e+00 | 99.2% |
| 436 | GQ904080 | Aphis argrimoniae isolate 080925HJ29 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 643.0 | 0.00e+00 | 99.2% |
| 437 | GQ904148 | Aphis sp. K-4 no.1 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 643.0 | 0.00e+00 | 99.2% |
| 438 | KY679368 | Aphis gossypii clone pmk5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 643.0 | 0.00e+00 | 99.2% |
| 439 | MN319812 | Aphis gossypii voucher NIBGE APH-00158 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 645.0 | 0.00e+00 | 99.1% |
| 440 | KY679409 | Aphis gossypii clone msm6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 640.0 | 0.00e+00 | 99.1% |
| 441 | MN319729 | Aphis gossypii voucher NIBGE APH-00734 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 640.0 | 0.00e+00 | 99.1% |
| 442 | JQ690335 | Aphis gossypii voucher KBRIIHR-42 from India cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 634.0 | 0.00e+00 | 98.8% |
| 443 | KM268006 | Aphis gossypii voucher ORP SP-LK30 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 631.0 | 0.00e+00 | 98.6% |
| 444 | EU701473 | Aphis oestlundi voucher CNC#HEM006239 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 628.0 | 0.00e+00 | 98.5% |
| 445 | GU668711 | Aphis sp. RFBAE765-09 voucher CNC#HEM063709 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 628.0 | 0.00e+00 | 98.5% |
| 446 | GU668325 | Aphis sp. RFBAE389-09 voucher CNC#HEM063334 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 621.0 | 0.00e+00 | 98.5% |
| 447 | JQ916174 | Aphis commensalis voucher ZMIOZ 17982 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 641 | 97.4% | 611.0 | 0.00e+00 | 98.4% |
| 448 | EU701487 | Aphis sp. D RGF-2008 voucher CNC#HEM028506 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 626.0 | 0.00e+00 | 98.3% |
| 449 | HQ979390 | Aphis oestlundi voucher BIOUG| 658 |
100.0% |
625.0 |
0.00e+00 |
98.3% |
|
| 450 | KR856186 | Aphis gossypii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 625.0 | 0.00e+00 | 98.3% |
| 451 | PP349797 | Aphis gossypii isolate Ag22 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 452 | GQ904135 | Aphis sp. C-2 no.2 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 453 | MN521053 | Aphis sp. SAEVG Morph0289 cytochrome oxidase subunit I (CO1) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 454 | KF639041 | Aphis serpylli voucher INRA CBGP ACOE1006/chasses1006-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 455 | KR035423 | Aphis madderae voucher CNC#HEM057319 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 456 | MN319717 | Aphis gossypii voucher NIBGE APH-00580 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 457 | MW315434 | Aphis gossypii voucher A29 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 458 | AB506732 | Aphis gossypii mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agos7 | 658 | 100.0% | 622.0 | 0.00e+00 | 98.2% |
| 459 | MW315409 | Aphis gossypii voucher A01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 99.1% | 616.0 | 0.00e+00 | 98.2% |
| 460 | KR034759 | Aphis madderae voucher CNC#HEM057290 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 620.0 | 0.00e+00 | 98.0% |
| 461 | KF639053 | Aphis cf. frangulae INRA CBGP ACOE691/chasses691-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 462 | EU701488 | Aphis sp. E RGF-2008 voucher CNC#HEM011120 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 463 | KX371819 | Aphis punicae voucher ROAppun1-16 cytochrome c oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 464 | KF638748 | Aphis alienus voucher INRA CBGP ACOE621/chasses621-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 465 | KF638967 | Aphis mamonthovae voucher INRA CBGP ACOE1658/chasses1658-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 466 | KF638988 | Aphis origani voucher INRA CBGP ACOE1467/chasses1467-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 619.0 | 0.00e+00 | 98.0% |
| 467 | KF638960 | Aphis lichtensteini voucher INRA CBGP ACOE929/chasses929-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 468 | KF639044 | Aphis serpylli voucher INRA CBGP ACOE827/chasses827-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 469 | KF638753 | Aphis cisticola voucher INRA CBGP ACOE1464/chasses1464-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 470 | GQ904114 | Aphis sumire isolate 050513HJ21 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 471 | MN320046 | Aphis affinis voucher NIBGE APH-00322 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 472 | MN320027 | Aphis affinis voucher NIBGE APH-00600 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 473 | MN320091 | Aphis affinis voucher NIBGE APH-00603 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 474 | MN320175 | Aphis affinis voucher NIBGE APH-00601 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 475 | EU701485 | Aphis sp. B RGF-2008 voucher CNC#HEM049387 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 476 | KF638989 | Aphis origani voucher INRA CBGP ACOE1513/chasses1513-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 477 | MN319859 | Aphis affinis voucher NIBGE APH-00602 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 478 | KF638966 | Aphis mamonthovae voucher INRA CBGP ACOE1578/chasses1578-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 479 | MN320264 | Aphis affinis voucher NIBGE APH-00604 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 480 | MN319862 | Aphis affinis voucher NIBGE APH-00731 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 614.0 | 0.00e+00 | 97.7% |
| 481 | KF639042 | Aphis serpylli voucher INRA CBGP ACOE1382/chasses1382-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 482 | KP189455 | Aphis affinis voucher ORP SP-LK138 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 483 | KF639046 | Aphis cf. frangulae INRA CBGP ACOE1054/chasses1054-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 484 | MN319892 | Aphis affinis voucher NIBGE APH-00650 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 485 | HQ632648 | Aphis punicae voucher IIHR-BT-18 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 486 | EU701486 | Aphis sp. C RGF-2008 voucher CNC#HEM049294 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 613.0 | 0.00e+00 | 97.7% |
| 487 | KF639015 | Aphis ruborum voucher INRA CBGP ACOE1560/chasses1560-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 488 | ON929005 | Aphis ruborum cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 489 | EU930141 | Aphis frangulae strain Afr-Arm cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 490 | EU701440 | Aphis idaei voucher CNC#HEM051747 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 491 | KF639113 | Aphis viticis voucher INRA CBGP ACOE1495/chasses1495-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 492 | EU930140 | Aphis frangulae strain Afr-3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 493 | EU930139 | Aphis frangulae strain Afr-2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 610.0 | 0.00e+00 | 97.6% |
| 494 | EU701439 | Aphis idaei voucher CNC#HEM055910 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 606.0 | 0.00e+00 | 97.6% |
| 495 | MK748447 | Aphis ruborum voucher GM0002 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
| 496 | KF639043 | Aphis serpylli voucher INRA CBGP ACOE1569/chasses1569-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
| 497 | KF639112 | Aphis viticis voucher INRA CBGP ACOE1367/chasses1367-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
| 498 | KF639012 | Aphis ruborum voucher INRA CBGP ACOE1407/chasses1407-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
| 499 | MK748446 | Aphis ruborum voucher GM0001 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
| 500 | OK181931 | Aphis ruborum isolate 1/2017_Trisov cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 607.0 | 0.00e+00 | 97.4% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Aphis gossypii | species | Aphis gossypii | Aphis gossypii | KY679353 | 1.0 |
| Aphididae | family | Aphididae | Aphis gossypii | KY679353 | 1.0 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 1056 sequences in the reference database for Aphis gossypii at the given locus COI.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |